Title: Synthesized PCR primers from Kenyan GRSV Ribonucleic Acid strains Contiguous Sequences
Authors: L W Murere, B Mukoye
Volume: 9
Issue: 10
Pages: 102-109
Publication Date: 2025/10/28
Abstract:
Groundnut ringspot virus (GRSV) is among the emerging viruses in genus of Tospovirus, which are of economic importance on legumes, solanaceae among other families resulting into reduction of yield and marketability of the crop product. Some diagnostic tools i.e. use of biological symptoms, ELISA among others are in use to determine the virus in a sample. However, the most reliable method is the use of Polymarase Chain Reaction (PCR). Polymarase Chain Reaction primers are short, nucleic acid sequence Single- stranded segments of DNA that are designed to be complementary to the beginning and end of the target sequence that will be amplified. The two primers developed; one for each of the complementary single strands of DNA released during denaturation. The forward primer attaches to the start codon of the template DNA (the anti-sense strand) while the reverse primer attaches (binds) to the sense strand of the DNA. Typical Symptoms for GRSV appears on groundnuts and other plants in Kenya but since no study had been done in Kenya, therefore no primer had been designed and synthesized from Kenyan isolates to compare with commercial primers. This was the first research about GRSV occurrence and development of GRSV primers from Kenyan GRSV isolates. The objective of this research was to evaluate the contigs of Kenyan GRSV isolates for development of GRSV primers. The developed new set of PCR primers was to synthesizing DNA with a free terminal end and initiation point of polymerase from Kenyan GRSV samples. The aim of this study was to determine the effectiveness of New set PCR primers in detection of GRSV in a sample in comparison with already existing commercial primers. The GRSV symptomatic Groundnut leave samples picked in a survey conducted in western Kenya. Serological analysis was done using polyclonal antisera against GRSV. Total RNA of Kenyan plant isolates extracted using CTAB and purified by DCC(tm)-5 purification kit then amplified using target GRSVnR(5'GCGGTCTACAGTGTTGCACTT3') and GRSVnF (5'TCTTGTGCATCATCCATTGT-3') using Rt-PCR at 614-bp fragment of the nucleocapsid gene of GRSV corresponding to the part of the nucleocapsid (N) gene. The RT-PCR product taken for Sanger sequencing. Sequence readings trimmed using Bio-edit software. New primers from GRSV sequences of western Kenya was designed using primer3plus software, synthesized and validated using PCR tests. A set of developed primers formed clear bands in a PCR tests with positive samples of western Kenya. New designed and developed primers from GRSV sequences of western Kenya; GRSV4 F (5" ACCAGAACCAGGTTGCATTC 3") and GRSV4R (5" ATCGTGACCTTGCCAAAAGT 3"), have the potential of being used to synthesis a standard commercial PCR primers to amplify RNA of GRSV isolates and be used both locally and globally for PCR tests